|
Authored by: Anonymous on Monday, April 15 2013 @ 11:34 AM EDT |
For illustrative purposes, Myriad has a patent on a new composition of matter,
call it ACTGGGTACAAAAC.
while its true that ACTGGGTACAAAAC can sometimes be found in much larger
chemicals such as :
ACTGACTTGGTCCAACTGGGTACAAAACACTTGGGAAACGTACGTTGTGTGACDCTAGGGTAAGTGATACTGTGTGACTA
CTGAACGTTACTCCCCCCAAACTGTGACAGAGAGATACATGGGACACACGTGTACTGAGTTGACTAG
ACTGGGTACAAAAC is not naturally occurring in isolation. Myriad found it, found
its purpose or effect and found a use for it. As such, they claimed it as their
invention.
Seems fair to me.[ Reply to This | Parent | # ]
|
|
Authored by: macliam on Monday, April 15 2013 @ 01:10 PM EDT |
The case law concerning patentability of products derived from natural
products through being ‘isolated’ and/or ‘purified’ is
discussed by the Solicitor General on pages 22 to 26 of the Brief amicus curiae for the United
States in support of neither party. The brief as a whole argues for the
petitioners (i.e., those fighting patents on human genes) in most respects, but
advocates the patentability of cDNA.
On page 26 of that brief
(concluding section C1(b)), the Solicitor General summarizes his conclusions
with regard to the ‘purification’ cases and their applicability to
patentability of genes in the following terms:
Those decisions
indicate that certain purification processes—i.e., processes that involve
human manipulation
of a substance that has been removed in impure form
from its
natural environment—may sometimes result in
an altered substance that has
structural features and/or
operative properties that render the product
markedly
different from the impure substance that occurs in nature. For
instance, cDNA could be thought of as a “purified” gene, as it
incorporates into a single contiguous, synthetic molecule only the coding
regions of the naturally occurring gene. But isolated DNA reflects no such
transformation. As explained above, isolated DNA has simply been removed from
its natural environment within the human body, with minor structural changes
that have no effect on its intrinsic properties, so that those properties may be
observed and exploited in a laboratory setting. To label the process of removing
DNA from a cell “purification,” and to hold the culled DNA segments
patent-eligible on that ground, would “make patent eligibility depend
simply on the draftsman’s art,” without reference to the nature and extent
of the underlying transformation, or the consequences for the public’s ability
to use the underlying substance. See Mayo, 132 S. Ct. at 1294 (citation and
internal quotation marks omitted).
The Solicitor General
mentions the aspirin case, and cases, such as the In re Marden
cases, that denied patentability to purified metals like tungsten and
vanadium. [ Reply to This | Parent | # ]
|
|
|
|
|